ID: 930539112_930539115

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 930539112 930539115
Species Human (GRCh38) Human (GRCh38)
Location 2:52681640-52681662 2:52681661-52681683
Sequence CCTGCTAACATTGGTGCCAGTGT GTATGCTAACCTGGAGCCCAAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 13, 3: 34, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!