ID: 930606297_930606303

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 930606297 930606303
Species Human (GRCh38) Human (GRCh38)
Location 2:53496834-53496856 2:53496882-53496904
Sequence CCAGTCATACAAACGTGCGACTC ATTTCTCCTCAGTGGTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22} {0: 1, 1: 1, 2: 2, 3: 10, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!