|
Left Crispr |
Right Crispr |
| Crispr ID |
930624306 |
930624309 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:53679469-53679491
|
2:53679483-53679505
|
| Sequence |
CCATCCTCATCTTTCTTCTCCAT |
CTTCTCCATCTCAAAGAAATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 17, 3: 193, 4: 1440} |
{0: 1, 1: 0, 2: 3, 3: 30, 4: 307} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|