ID: 930627782_930627783

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 930627782 930627783
Species Human (GRCh38) Human (GRCh38)
Location 2:53718168-53718190 2:53718196-53718218
Sequence CCAGATAGAAGCAATACAGAGAA TGTGAACGTGAATATCACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 80, 4: 377} {0: 1, 1: 0, 2: 0, 3: 13, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!