|
Left Crispr |
Right Crispr |
| Crispr ID |
930660158 |
930660172 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:54045246-54045268
|
2:54045282-54045304
|
| Sequence |
CCCTCCACGATCCCCTTAAAAAC |
TCCTTGGGGAGATGGATTTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 28, 2: 60, 3: 68, 4: 172} |
{0: 19, 1: 49, 2: 99, 3: 154, 4: 373} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|