ID: 930683216_930683221

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 930683216 930683221
Species Human (GRCh38) Human (GRCh38)
Location 2:54279957-54279979 2:54279989-54280011
Sequence CCATGCCCATTTTAAGATAAACT GGGAAGATAAATGCAAGTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 243} {0: 1, 1: 0, 2: 1, 3: 25, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!