|
Left Crispr |
Right Crispr |
| Crispr ID |
930703929 |
930703935 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:54485874-54485896
|
2:54485894-54485916
|
| Sequence |
CCGGCCGCGACCCGTCTGGGAGG |
AGGTGAGGAGCGTCTCTGCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 9, 3: 16, 4: 157} |
{0: 806, 1: 3903, 2: 7547, 3: 9606, 4: 4570} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|