ID: 930722942_930722949

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 930722942 930722949
Species Human (GRCh38) Human (GRCh38)
Location 2:54655483-54655505 2:54655524-54655546
Sequence CCATTGACTATGCCCTAGATCAG GTTGGTGATTCTGGTTAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 82} {0: 1, 1: 0, 2: 0, 3: 9, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!