ID: 930728933_930728939

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 930728933 930728939
Species Human (GRCh38) Human (GRCh38)
Location 2:54709359-54709381 2:54709378-54709400
Sequence CCCAGCTCCTGCTGCTCACTCTG TCTGATCTCGGAGCAAGGTTGGG
Strand - +
Off-target summary No data {0: 3, 1: 6, 2: 25, 3: 75, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!