ID: 930752739_930752757

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 930752739 930752757
Species Human (GRCh38) Human (GRCh38)
Location 2:54948566-54948588 2:54948618-54948640
Sequence CCCCTCTTGTTTCAAGCCCACAT AAGGTTAAGCAGAGGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 150} {0: 1, 1: 0, 2: 3, 3: 37, 4: 615}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!