ID: 930763203_930763206

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 930763203 930763206
Species Human (GRCh38) Human (GRCh38)
Location 2:55058477-55058499 2:55058527-55058549
Sequence CCAGCTACCAGCCACTTTCAGGC TTTTGTTGACGAAATTTTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150} {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!