ID: 930780807_930780818

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 930780807 930780818
Species Human (GRCh38) Human (GRCh38)
Location 2:55223672-55223694 2:55223707-55223729
Sequence CCCGGACCCGCTCAGCGGTCCCT CGCCCCCAGGAGCCTCGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 81} {0: 2, 1: 0, 2: 1, 3: 13, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!