ID: 930780996_930781000

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 930780996 930781000
Species Human (GRCh38) Human (GRCh38)
Location 2:55224739-55224761 2:55224771-55224793
Sequence CCTTGTGTCCATGAGAACATCAG TCAGGAAATTCAGCAAGACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200} {0: 1, 1: 1, 2: 2, 3: 16, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!