ID: 930790173_930790179

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 930790173 930790179
Species Human (GRCh38) Human (GRCh38)
Location 2:55317323-55317345 2:55317343-55317365
Sequence CCTTTCTGTTTTAATAACTGATT ATTGTAACTGGGGGGAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 530} {0: 1, 1: 0, 2: 3, 3: 30, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!