ID: 930817673_930817677

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 930817673 930817677
Species Human (GRCh38) Human (GRCh38)
Location 2:55616271-55616293 2:55616312-55616334
Sequence CCTTTCCTCATTAAGAACAAAAG GATGACTATTTAAAATAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 396} {0: 1, 1: 1, 2: 3, 3: 67, 4: 670}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!