ID: 930822019_930822023

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 930822019 930822023
Species Human (GRCh38) Human (GRCh38)
Location 2:55655835-55655857 2:55655878-55655900
Sequence CCTTCCTCTCTCTGTTAACCTTG AATAAAGAAACAAGCCAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 350} {0: 1, 1: 1, 2: 2, 3: 87, 4: 962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!