ID: 930851743_930851758

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 930851743 930851758
Species Human (GRCh38) Human (GRCh38)
Location 2:55968471-55968493 2:55968522-55968544
Sequence CCCCACCCCTCCACCATGTGAGG CCGGGAAGAGAACCCTTACCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 22, 3: 106, 4: 486} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!