ID: 930872850_930872867

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 930872850 930872867
Species Human (GRCh38) Human (GRCh38)
Location 2:56185015-56185037 2:56185054-56185076
Sequence CCCGGTCGGCACCCCCTACCCCC GTAACTTTTCCAAACTTCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256} {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!