ID: 930872851_930872866

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 930872851 930872866
Species Human (GRCh38) Human (GRCh38)
Location 2:56185016-56185038 2:56185051-56185073
Sequence CCGGTCGGCACCCCCTACCCCCA TGTGTAACTTTTCCAAACTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 346} {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!