ID: 930881546_930881555

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 930881546 930881555
Species Human (GRCh38) Human (GRCh38)
Location 2:56276394-56276416 2:56276434-56276456
Sequence CCCAAATCTCATCTTGAATTGTA GTGTCGTAGGAGGAACTGGTGGG
Strand - +
Off-target summary {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679} {0: 1, 1: 0, 2: 5, 3: 58, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!