ID: 930910148_930910154

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 930910148 930910154
Species Human (GRCh38) Human (GRCh38)
Location 2:56620868-56620890 2:56620916-56620938
Sequence CCTGGCATCTTCTGCAGATAACT CACCTGGTAATGGGATTTGGTGG
Strand - +
Off-target summary {0: 3, 1: 213, 2: 170, 3: 132, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!