ID: 930946760_930946772

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 930946760 930946772
Species Human (GRCh38) Human (GRCh38)
Location 2:57084783-57084805 2:57084827-57084849
Sequence CCGGCACCCAAGAGGGAGGCCTA CTGCTGGAGCCATGCCTGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 42, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!