ID: 930987288_930987293

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 930987288 930987293
Species Human (GRCh38) Human (GRCh38)
Location 2:57605798-57605820 2:57605822-57605844
Sequence CCAAAGTTGCTTATCAGCTTAAG AGTTTTTGGGCTGAGACGTTGGG
Strand - +
Off-target summary {0: 111, 1: 101, 2: 59, 3: 50, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!