ID: 931011135_931011139

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 931011135 931011139
Species Human (GRCh38) Human (GRCh38)
Location 2:57915732-57915754 2:57915746-57915768
Sequence CCAACCCGCTGGGCTGCAGACCA TGCAGACCAGTACCGGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 59, 4: 283} {0: 1, 1: 1, 2: 17, 3: 73, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!