ID: 931014137_931014146

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 931014137 931014146
Species Human (GRCh38) Human (GRCh38)
Location 2:57956085-57956107 2:57956122-57956144
Sequence CCCTGCAGCATTAAAAATAGTAT GTGGCTAATGCCGCTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 309} {0: 1, 1: 1, 2: 17, 3: 32, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!