ID: 931021342_931021345

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 931021342 931021345
Species Human (GRCh38) Human (GRCh38)
Location 2:58047416-58047438 2:58047432-58047454
Sequence CCCTGAGAGGCTGTCGTTTCCCT TTTCCCTTGGCAGATGAACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120} {0: 1, 1: 0, 2: 1, 3: 13, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!