ID: 931036618_931036626

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 931036618 931036626
Species Human (GRCh38) Human (GRCh38)
Location 2:58251444-58251466 2:58251478-58251500
Sequence CCACACCGGCGGTACCAGCAAGT CACGCCAGCCCCAGTCCCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 14, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!