ID: 931050380_931050383

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931050380 931050383
Species Human (GRCh38) Human (GRCh38)
Location 2:58407313-58407335 2:58407334-58407356
Sequence CCGAGCACAGCGGCATGTGCCTG TGTTATCCCAGCTACTCAGGAGG
Strand - +
Off-target summary No data {0: 316, 1: 56486, 2: 148292, 3: 234787, 4: 204415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!