ID: 931058293_931058297

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 931058293 931058297
Species Human (GRCh38) Human (GRCh38)
Location 2:58497706-58497728 2:58497738-58497760
Sequence CCTCGAACTATCCTTTTGCTTTA TCTCCCCGCTTTTAAAGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!