ID: 931107854_931107862

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 931107854 931107862
Species Human (GRCh38) Human (GRCh38)
Location 2:59076940-59076962 2:59076974-59076996
Sequence CCATGCTAATTGAGGCAATGAAG CAACTTTGTACAGAGACTAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!