ID: 931225372_931225381

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 931225372 931225381
Species Human (GRCh38) Human (GRCh38)
Location 2:60324795-60324817 2:60324815-60324837
Sequence CCCTCCCCACCTACCTTCCACCC CCCCACCCTGTGCCTTCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 231, 4: 2706} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!