ID: 931246628_931246634

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 931246628 931246634
Species Human (GRCh38) Human (GRCh38)
Location 2:60497930-60497952 2:60497950-60497972
Sequence CCCACCGCTTCATTGGCCGAGGA GGATGACCCCATAAAGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27} {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!