ID: 931252655_931252664

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 931252655 931252664
Species Human (GRCh38) Human (GRCh38)
Location 2:60547760-60547782 2:60547795-60547817
Sequence CCCTACCCAGGCTGAATATTGAG GAGTAACTCCCAGATGTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 137} {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!