ID: 931316417_931316421

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931316417 931316421
Species Human (GRCh38) Human (GRCh38)
Location 2:61136795-61136817 2:61136816-61136838
Sequence CCCTGCACCTACTAAAAATAAAA AAAAAATTAGCCAGGCGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 200, 3: 6309, 4: 88538} {0: 480, 1: 18140, 2: 83417, 3: 170780, 4: 198419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!