|
Left Crispr |
Right Crispr |
| Crispr ID |
931316417 |
931316422 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:61136795-61136817
|
2:61136820-61136842
|
| Sequence |
CCCTGCACCTACTAAAAATAAAA |
AATTAGCCAGGCGTGATGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 200, 3: 6309, 4: 88538} |
{0: 379, 1: 13057, 2: 47707, 3: 77915, 4: 70617} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|