|
Left Crispr |
Right Crispr |
Crispr ID |
931331140 |
931331146 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:61285370-61285392
|
2:61285395-61285417
|
Sequence |
CCATCTACTTTGGAGGCTGAGAA |
GAGGAACACCTGAGTCTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 9, 2: 476, 3: 12887, 4: 147415} |
{0: 1, 1: 65, 2: 1111, 3: 5015, 4: 14669} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|