ID: 931331140_931331146

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 931331140 931331146
Species Human (GRCh38) Human (GRCh38)
Location 2:61285370-61285392 2:61285395-61285417
Sequence CCATCTACTTTGGAGGCTGAGAA GAGGAACACCTGAGTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 476, 3: 12887, 4: 147415} {0: 1, 1: 65, 2: 1111, 3: 5015, 4: 14669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!