ID: 931333269_931333276

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 931333269 931333276
Species Human (GRCh38) Human (GRCh38)
Location 2:61311248-61311270 2:61311263-61311285
Sequence CCTTCCACCCTCTGCCTGTGAGG CTGTGAGGAGGCAGCATTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 423} {0: 1, 1: 0, 2: 5, 3: 31, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!