ID: 931341740_931341743

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 931341740 931341743
Species Human (GRCh38) Human (GRCh38)
Location 2:61408543-61408565 2:61408574-61408596
Sequence CCTACAATTCTTCTGATTAACAG TTTGATGTTTAGGAAAAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168} {0: 1, 1: 0, 2: 3, 3: 19, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!