ID: 931396126_931396142

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 931396126 931396142
Species Human (GRCh38) Human (GRCh38)
Location 2:61889505-61889527 2:61889545-61889567
Sequence CCACCCGGAGGTGCCCTCCTTTA CCGCGAGGTGGGGTGGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69} {0: 1, 1: 0, 2: 3, 3: 29, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!