ID: 931396895_931396907

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 931396895 931396907
Species Human (GRCh38) Human (GRCh38)
Location 2:61895726-61895748 2:61895776-61895798
Sequence CCGTTAGGGCCAGTACTGCCTGC GAAGCTTACCAGGAAACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110} {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!