ID: 931484509_931484516

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 931484509 931484516
Species Human (GRCh38) Human (GRCh38)
Location 2:62676666-62676688 2:62676714-62676736
Sequence CCAAGCCATTGTTTTGCTGGAAA TTTTTTTAAAGGGCCTTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 237} {0: 1, 1: 0, 2: 1, 3: 18, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!