ID: 931487489_931487494

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 931487489 931487494
Species Human (GRCh38) Human (GRCh38)
Location 2:62707005-62707027 2:62707033-62707055
Sequence CCATTCATCTAAGATGGGATTTA TGAAACAGGGAGAAGACTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 418} {0: 1, 1: 0, 2: 1, 3: 24, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!