ID: 931494288_931494291

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 931494288 931494291
Species Human (GRCh38) Human (GRCh38)
Location 2:62785236-62785258 2:62785289-62785311
Sequence CCACTAATGGATCATAACCCACA ATTGAAATGTGCAAAACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 16, 4: 132} {0: 1, 1: 0, 2: 1, 3: 25, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!