ID: 931528016_931528025

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 931528016 931528025
Species Human (GRCh38) Human (GRCh38)
Location 2:63179482-63179504 2:63179521-63179543
Sequence CCCTTCTCTTTCTCCTTCTCCAG CCATTTCACCTTCTGCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 35, 3: 370, 4: 2265} {0: 1, 1: 0, 2: 11, 3: 64, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!