|
Left Crispr |
Right Crispr |
| Crispr ID |
931559289 |
931559291 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:63540835-63540857
|
2:63540857-63540879
|
| Sequence |
CCACAACTTCTCAGGCTCAAGTG |
GATCCTCCCTCCAAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 268, 2: 1779, 3: 6890, 4: 26553} |
{0: 1, 1: 2, 2: 9, 3: 97, 4: 867} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|