ID: 931564529_931564537

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 931564529 931564537
Species Human (GRCh38) Human (GRCh38)
Location 2:63601630-63601652 2:63601673-63601695
Sequence CCTGGCCTTTGCTGTCCAGACAG TAGAAGGAGCAAGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221} {0: 1, 1: 0, 2: 26, 3: 397, 4: 2426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!