ID: 931572566_931572574

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 931572566 931572574
Species Human (GRCh38) Human (GRCh38)
Location 2:63684270-63684292 2:63684307-63684329
Sequence CCCTTTTTGCTGTAGGCCCAAGT TGGGCAAGTTCATGAAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144} {0: 6, 1: 4, 2: 2, 3: 20, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!