ID: 931573795_931573800

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 931573795 931573800
Species Human (GRCh38) Human (GRCh38)
Location 2:63698510-63698532 2:63698529-63698551
Sequence CCTCTAGAATCTAATCCCTCTGT CTGTTGGCACAGACTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139} {0: 1, 1: 0, 2: 1, 3: 36, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!