ID: 931578054_931578058

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 931578054 931578058
Species Human (GRCh38) Human (GRCh38)
Location 2:63741073-63741095 2:63741102-63741124
Sequence CCAGGAAGTCAGATGTTTCTGGA CTGCCTTTAGGGAAGGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 210} {0: 1, 1: 1, 2: 2, 3: 46, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!