ID: 931599214_931599216

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 931599214 931599216
Species Human (GRCh38) Human (GRCh38)
Location 2:63986412-63986434 2:63986433-63986455
Sequence CCATCCATCTGTTGCAAATGACA CAAGATCTCATCCTTTTCTATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 9, 3: 42, 4: 249} {0: 1, 1: 11, 2: 342, 3: 9181, 4: 23552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!